ID: 904306565

View in Genome Browser
Species Human (GRCh38)
Location 1:29593921-29593943
Sequence AAGAGGGAGGAGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904306548_904306565 20 Left 904306548 1:29593878-29593900 CCTCACTGCTGAACTCTTCTTTC No data
Right 904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG No data
904306557_904306565 -2 Left 904306557 1:29593900-29593922 CCAGGGTGTGTGGGAAGGGGGAA No data
Right 904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904306565 Original CRISPR AAGAGGGAGGAGAAGGGGGC AGG Intergenic
No off target data available for this crispr