ID: 904308759

View in Genome Browser
Species Human (GRCh38)
Location 1:29611525-29611547
Sequence CCTGTACCTTCTCCCCGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904308755_904308759 -2 Left 904308755 1:29611504-29611526 CCTAGGTCCCTGACATAGATTCC No data
Right 904308759 1:29611525-29611547 CCTGTACCTTCTCCCCGTTGTGG No data
904308754_904308759 10 Left 904308754 1:29611492-29611514 CCTCAAATATAGCCTAGGTCCCT No data
Right 904308759 1:29611525-29611547 CCTGTACCTTCTCCCCGTTGTGG No data
904308757_904308759 -10 Left 904308757 1:29611512-29611534 CCTGACATAGATTCCTGTACCTT No data
Right 904308759 1:29611525-29611547 CCTGTACCTTCTCCCCGTTGTGG No data
904308756_904308759 -9 Left 904308756 1:29611511-29611533 CCCTGACATAGATTCCTGTACCT No data
Right 904308759 1:29611525-29611547 CCTGTACCTTCTCCCCGTTGTGG No data
904308752_904308759 28 Left 904308752 1:29611474-29611496 CCTTCTGGACTTTTTGTTCCTCA No data
Right 904308759 1:29611525-29611547 CCTGTACCTTCTCCCCGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904308759 Original CRISPR CCTGTACCTTCTCCCCGTTG TGG Intergenic
No off target data available for this crispr