ID: 904310129

View in Genome Browser
Species Human (GRCh38)
Location 1:29623778-29623800
Sequence GTCTCCTCCTGGGTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904310125_904310129 -3 Left 904310125 1:29623758-29623780 CCCTTCGGTGTGCTTTCTGGGTC No data
Right 904310129 1:29623778-29623800 GTCTCCTCCTGGGTGCTGCCTGG No data
904310126_904310129 -4 Left 904310126 1:29623759-29623781 CCTTCGGTGTGCTTTCTGGGTCT No data
Right 904310129 1:29623778-29623800 GTCTCCTCCTGGGTGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904310129 Original CRISPR GTCTCCTCCTGGGTGCTGCC TGG Intergenic