ID: 904312691

View in Genome Browser
Species Human (GRCh38)
Location 1:29639589-29639611
Sequence ACCTCAGAGAATATACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904312684_904312691 20 Left 904312684 1:29639546-29639568 CCAGGCACAAGGCTGTATCCTAG No data
Right 904312691 1:29639589-29639611 ACCTCAGAGAATATACATTCTGG No data
904312688_904312691 2 Left 904312688 1:29639564-29639586 CCTAGGGAAACAGACCTGGCCTC No data
Right 904312691 1:29639589-29639611 ACCTCAGAGAATATACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904312691 Original CRISPR ACCTCAGAGAATATACATTC TGG Intergenic
No off target data available for this crispr