ID: 904313071

View in Genome Browser
Species Human (GRCh38)
Location 1:29641847-29641869
Sequence CAGTTTCAGCAGAGGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904313058_904313071 10 Left 904313058 1:29641814-29641836 CCCCTCCCACTCTGCCTGCACCT No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313057_904313071 11 Left 904313057 1:29641813-29641835 CCCCCTCCCACTCTGCCTGCACC No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313063_904313071 5 Left 904313063 1:29641819-29641841 CCCACTCTGCCTGCACCTAGGGA No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313060_904313071 8 Left 904313060 1:29641816-29641838 CCTCCCACTCTGCCTGCACCTAG No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313051_904313071 29 Left 904313051 1:29641795-29641817 CCCACCTCCCTCCTCGTACCCCC No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313055_904313071 21 Left 904313055 1:29641803-29641825 CCTCCTCGTACCCCCTCCCACTC No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313059_904313071 9 Left 904313059 1:29641815-29641837 CCCTCCCACTCTGCCTGCACCTA No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313065_904313071 -4 Left 904313065 1:29641828-29641850 CCTGCACCTAGGGAACTTCCAGT No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313064_904313071 4 Left 904313064 1:29641820-29641842 CCACTCTGCCTGCACCTAGGGAA No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313056_904313071 18 Left 904313056 1:29641806-29641828 CCTCGTACCCCCTCCCACTCTGC No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313053_904313071 25 Left 904313053 1:29641799-29641821 CCTCCCTCCTCGTACCCCCTCCC No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313066_904313071 -10 Left 904313066 1:29641834-29641856 CCTAGGGAACTTCCAGTTTCAGC No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313054_904313071 22 Left 904313054 1:29641802-29641824 CCCTCCTCGTACCCCCTCCCACT No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313050_904313071 30 Left 904313050 1:29641794-29641816 CCCCACCTCCCTCCTCGTACCCC No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data
904313052_904313071 28 Left 904313052 1:29641796-29641818 CCACCTCCCTCCTCGTACCCCCT No data
Right 904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904313071 Original CRISPR CAGTTTCAGCAGAGGGACCA GGG Intergenic
No off target data available for this crispr