ID: 904314515

View in Genome Browser
Species Human (GRCh38)
Location 1:29651604-29651626
Sequence CAGCAACCATTCAGGAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904314515_904314525 30 Left 904314515 1:29651604-29651626 CCACTGTTCCTGAATGGTTGCTG No data
Right 904314525 1:29651657-29651679 GCTGCCCGTACTGGCCATGCTGG No data
904314515_904314518 8 Left 904314515 1:29651604-29651626 CCACTGTTCCTGAATGGTTGCTG No data
Right 904314518 1:29651635-29651657 CAGAACACCCTCCCTCACCTTGG No data
904314515_904314523 21 Left 904314515 1:29651604-29651626 CCACTGTTCCTGAATGGTTGCTG No data
Right 904314523 1:29651648-29651670 CTCACCTTGGCTGCCCGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904314515 Original CRISPR CAGCAACCATTCAGGAACAG TGG (reversed) Intergenic
No off target data available for this crispr