ID: 904314517

View in Genome Browser
Species Human (GRCh38)
Location 1:29651612-29651634
Sequence CTCCAGAGCAGCAACCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904314517_904314528 30 Left 904314517 1:29651612-29651634 CCTGAATGGTTGCTGCTCTGGAG No data
Right 904314528 1:29651665-29651687 TACTGGCCATGCTGGCTCTCTGG No data
904314517_904314525 22 Left 904314517 1:29651612-29651634 CCTGAATGGTTGCTGCTCTGGAG No data
Right 904314525 1:29651657-29651679 GCTGCCCGTACTGGCCATGCTGG No data
904314517_904314518 0 Left 904314517 1:29651612-29651634 CCTGAATGGTTGCTGCTCTGGAG No data
Right 904314518 1:29651635-29651657 CAGAACACCCTCCCTCACCTTGG No data
904314517_904314523 13 Left 904314517 1:29651612-29651634 CCTGAATGGTTGCTGCTCTGGAG No data
Right 904314523 1:29651648-29651670 CTCACCTTGGCTGCCCGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904314517 Original CRISPR CTCCAGAGCAGCAACCATTC AGG (reversed) Intergenic
No off target data available for this crispr