ID: 904314519

View in Genome Browser
Species Human (GRCh38)
Location 1:29651642-29651664
Sequence CGGGCAGCCAAGGTGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904314519_904314529 1 Left 904314519 1:29651642-29651664 CCCTCCCTCACCTTGGCTGCCCG No data
Right 904314529 1:29651666-29651688 ACTGGCCATGCTGGCTCTCTGGG No data
904314519_904314532 12 Left 904314519 1:29651642-29651664 CCCTCCCTCACCTTGGCTGCCCG No data
Right 904314532 1:29651677-29651699 TGGCTCTCTGGGGCAGCACGAGG No data
904314519_904314530 2 Left 904314519 1:29651642-29651664 CCCTCCCTCACCTTGGCTGCCCG No data
Right 904314530 1:29651667-29651689 CTGGCCATGCTGGCTCTCTGGGG No data
904314519_904314533 28 Left 904314519 1:29651642-29651664 CCCTCCCTCACCTTGGCTGCCCG No data
Right 904314533 1:29651693-29651715 CACGAGGAGTTCAGAGCCCCAGG No data
904314519_904314525 -8 Left 904314519 1:29651642-29651664 CCCTCCCTCACCTTGGCTGCCCG No data
Right 904314525 1:29651657-29651679 GCTGCCCGTACTGGCCATGCTGG No data
904314519_904314528 0 Left 904314519 1:29651642-29651664 CCCTCCCTCACCTTGGCTGCCCG No data
Right 904314528 1:29651665-29651687 TACTGGCCATGCTGGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904314519 Original CRISPR CGGGCAGCCAAGGTGAGGGA GGG (reversed) Intergenic
No off target data available for this crispr