ID: 904314525

View in Genome Browser
Species Human (GRCh38)
Location 1:29651657-29651679
Sequence GCTGCCCGTACTGGCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904314520_904314525 -9 Left 904314520 1:29651643-29651665 CCTCCCTCACCTTGGCTGCCCGT No data
Right 904314525 1:29651657-29651679 GCTGCCCGTACTGGCCATGCTGG No data
904314515_904314525 30 Left 904314515 1:29651604-29651626 CCACTGTTCCTGAATGGTTGCTG No data
Right 904314525 1:29651657-29651679 GCTGCCCGTACTGGCCATGCTGG No data
904314519_904314525 -8 Left 904314519 1:29651642-29651664 CCCTCCCTCACCTTGGCTGCCCG No data
Right 904314525 1:29651657-29651679 GCTGCCCGTACTGGCCATGCTGG No data
904314517_904314525 22 Left 904314517 1:29651612-29651634 CCTGAATGGTTGCTGCTCTGGAG No data
Right 904314525 1:29651657-29651679 GCTGCCCGTACTGGCCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904314525 Original CRISPR GCTGCCCGTACTGGCCATGC TGG Intergenic
No off target data available for this crispr