ID: 904316499

View in Genome Browser
Species Human (GRCh38)
Location 1:29669594-29669616
Sequence CCCAGGGCTGTTCCCACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904316499_904316506 10 Left 904316499 1:29669594-29669616 CCTAGTGTGGGAACAGCCCTGGG No data
Right 904316506 1:29669627-29669649 TCCCCACTCTCCTCCTGACCAGG No data
904316499_904316514 28 Left 904316499 1:29669594-29669616 CCTAGTGTGGGAACAGCCCTGGG No data
Right 904316514 1:29669645-29669667 CCAGGCATCAGGTCAGCCAGAGG No data
904316499_904316510 17 Left 904316499 1:29669594-29669616 CCTAGTGTGGGAACAGCCCTGGG No data
Right 904316510 1:29669634-29669656 TCTCCTCCTGACCAGGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904316499 Original CRISPR CCCAGGGCTGTTCCCACACT AGG (reversed) Intergenic
No off target data available for this crispr