ID: 904317294

View in Genome Browser
Species Human (GRCh38)
Location 1:29673727-29673749
Sequence AGGTGGGCCCCAGGATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904317294_904317305 21 Left 904317294 1:29673727-29673749 CCTGGGCATCCTGGGGCCCACCT No data
Right 904317305 1:29673771-29673793 CATCTCCCTAGCAGGATGTGGGG No data
904317294_904317304 20 Left 904317294 1:29673727-29673749 CCTGGGCATCCTGGGGCCCACCT No data
Right 904317304 1:29673770-29673792 CCATCTCCCTAGCAGGATGTGGG No data
904317294_904317308 29 Left 904317294 1:29673727-29673749 CCTGGGCATCCTGGGGCCCACCT No data
Right 904317308 1:29673779-29673801 TAGCAGGATGTGGGGAATCCTGG No data
904317294_904317302 19 Left 904317294 1:29673727-29673749 CCTGGGCATCCTGGGGCCCACCT No data
Right 904317302 1:29673769-29673791 TCCATCTCCCTAGCAGGATGTGG No data
904317294_904317309 30 Left 904317294 1:29673727-29673749 CCTGGGCATCCTGGGGCCCACCT No data
Right 904317309 1:29673780-29673802 AGCAGGATGTGGGGAATCCTGGG No data
904317294_904317301 13 Left 904317294 1:29673727-29673749 CCTGGGCATCCTGGGGCCCACCT No data
Right 904317301 1:29673763-29673785 CAGACATCCATCTCCCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904317294 Original CRISPR AGGTGGGCCCCAGGATGCCC AGG (reversed) Intergenic
No off target data available for this crispr