ID: 904317640

View in Genome Browser
Species Human (GRCh38)
Location 1:29676108-29676130
Sequence GAGAGCACTGAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904317634_904317640 10 Left 904317634 1:29676075-29676097 CCTGTGTGTTGGGCCCTCAGCCG No data
Right 904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG No data
904317635_904317640 -3 Left 904317635 1:29676088-29676110 CCCTCAGCCGCTGCTTTACAGAG No data
Right 904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG No data
904317637_904317640 -10 Left 904317637 1:29676095-29676117 CCGCTGCTTTACAGAGAGCACTG No data
Right 904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG No data
904317633_904317640 11 Left 904317633 1:29676074-29676096 CCCTGTGTGTTGGGCCCTCAGCC No data
Right 904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG No data
904317636_904317640 -4 Left 904317636 1:29676089-29676111 CCTCAGCCGCTGCTTTACAGAGA No data
Right 904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG No data
904317632_904317640 12 Left 904317632 1:29676073-29676095 CCCCTGTGTGTTGGGCCCTCAGC No data
Right 904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904317640 Original CRISPR GAGAGCACTGAGAAGGAGGC TGG Intergenic
No off target data available for this crispr