ID: 904322866

View in Genome Browser
Species Human (GRCh38)
Location 1:29708093-29708115
Sequence CCTCCCTGTCTCCATGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904322855_904322866 27 Left 904322855 1:29708043-29708065 CCCCACTTCTCCTTCAGGTCTCA No data
Right 904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG No data
904322856_904322866 26 Left 904322856 1:29708044-29708066 CCCACTTCTCCTTCAGGTCTCAG 0: 5
1: 7
2: 46
3: 198
4: 943
Right 904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG No data
904322854_904322866 28 Left 904322854 1:29708042-29708064 CCCCCACTTCTCCTTCAGGTCTC No data
Right 904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG No data
904322857_904322866 25 Left 904322857 1:29708045-29708067 CCACTTCTCCTTCAGGTCTCAGC No data
Right 904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG No data
904322860_904322866 -8 Left 904322860 1:29708078-29708100 CCTCCTCCCAGAAGTCCTCCCTG No data
Right 904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG No data
904322858_904322866 17 Left 904322858 1:29708053-29708075 CCTTCAGGTCTCAGCGCAGACAC No data
Right 904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG No data
904322859_904322866 -5 Left 904322859 1:29708075-29708097 CCACCTCCTCCCAGAAGTCCTCC No data
Right 904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904322866 Original CRISPR CCTCCCTGTCTCCATGTCCA GGG Intergenic
No off target data available for this crispr