ID: 904326428

View in Genome Browser
Species Human (GRCh38)
Location 1:29729634-29729656
Sequence AGAGCTGGGACAGGACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904326428_904326438 3 Left 904326428 1:29729634-29729656 CCCTGGGGTCCTGTCCCAGCTCT No data
Right 904326438 1:29729660-29729682 GCTGCCTGGAAGGTGACCTGGGG No data
904326428_904326437 2 Left 904326428 1:29729634-29729656 CCCTGGGGTCCTGTCCCAGCTCT No data
Right 904326437 1:29729659-29729681 CGCTGCCTGGAAGGTGACCTGGG No data
904326428_904326436 1 Left 904326428 1:29729634-29729656 CCCTGGGGTCCTGTCCCAGCTCT No data
Right 904326436 1:29729658-29729680 GCGCTGCCTGGAAGGTGACCTGG No data
904326428_904326439 4 Left 904326428 1:29729634-29729656 CCCTGGGGTCCTGTCCCAGCTCT No data
Right 904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG No data
904326428_904326435 -7 Left 904326428 1:29729634-29729656 CCCTGGGGTCCTGTCCCAGCTCT No data
Right 904326435 1:29729650-29729672 CAGCTCTGGCGCTGCCTGGAAGG No data
904326428_904326442 22 Left 904326428 1:29729634-29729656 CCCTGGGGTCCTGTCCCAGCTCT No data
Right 904326442 1:29729679-29729701 GGGGGAACTCCCCTCTCCTCTGG No data
904326428_904326443 23 Left 904326428 1:29729634-29729656 CCCTGGGGTCCTGTCCCAGCTCT No data
Right 904326443 1:29729680-29729702 GGGGAACTCCCCTCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904326428 Original CRISPR AGAGCTGGGACAGGACCCCA GGG (reversed) Intergenic
No off target data available for this crispr