ID: 904326431

View in Genome Browser
Species Human (GRCh38)
Location 1:29729643-29729665
Sequence GGCAGCGCCAGAGCTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904326431_904326439 -5 Left 904326431 1:29729643-29729665 CCTGTCCCAGCTCTGGCGCTGCC No data
Right 904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG No data
904326431_904326442 13 Left 904326431 1:29729643-29729665 CCTGTCCCAGCTCTGGCGCTGCC No data
Right 904326442 1:29729679-29729701 GGGGGAACTCCCCTCTCCTCTGG No data
904326431_904326438 -6 Left 904326431 1:29729643-29729665 CCTGTCCCAGCTCTGGCGCTGCC No data
Right 904326438 1:29729660-29729682 GCTGCCTGGAAGGTGACCTGGGG No data
904326431_904326437 -7 Left 904326431 1:29729643-29729665 CCTGTCCCAGCTCTGGCGCTGCC No data
Right 904326437 1:29729659-29729681 CGCTGCCTGGAAGGTGACCTGGG No data
904326431_904326443 14 Left 904326431 1:29729643-29729665 CCTGTCCCAGCTCTGGCGCTGCC No data
Right 904326443 1:29729680-29729702 GGGGAACTCCCCTCTCCTCTGGG No data
904326431_904326436 -8 Left 904326431 1:29729643-29729665 CCTGTCCCAGCTCTGGCGCTGCC No data
Right 904326436 1:29729658-29729680 GCGCTGCCTGGAAGGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904326431 Original CRISPR GGCAGCGCCAGAGCTGGGAC AGG (reversed) Intergenic
No off target data available for this crispr