ID: 904326433

View in Genome Browser
Species Human (GRCh38)
Location 1:29729648-29729670
Sequence TTCCAGGCAGCGCCAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904326433_904326439 -10 Left 904326433 1:29729648-29729670 CCCAGCTCTGGCGCTGCCTGGAA No data
Right 904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG No data
904326433_904326442 8 Left 904326433 1:29729648-29729670 CCCAGCTCTGGCGCTGCCTGGAA No data
Right 904326442 1:29729679-29729701 GGGGGAACTCCCCTCTCCTCTGG No data
904326433_904326443 9 Left 904326433 1:29729648-29729670 CCCAGCTCTGGCGCTGCCTGGAA No data
Right 904326443 1:29729680-29729702 GGGGAACTCCCCTCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904326433 Original CRISPR TTCCAGGCAGCGCCAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr