ID: 904326439

View in Genome Browser
Species Human (GRCh38)
Location 1:29729661-29729683
Sequence CTGCCTGGAAGGTGACCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904326429_904326439 3 Left 904326429 1:29729635-29729657 CCTGGGGTCCTGTCCCAGCTCTG No data
Right 904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG No data
904326431_904326439 -5 Left 904326431 1:29729643-29729665 CCTGTCCCAGCTCTGGCGCTGCC No data
Right 904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG No data
904326428_904326439 4 Left 904326428 1:29729634-29729656 CCCTGGGGTCCTGTCCCAGCTCT No data
Right 904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG No data
904326433_904326439 -10 Left 904326433 1:29729648-29729670 CCCAGCTCTGGCGCTGCCTGGAA No data
Right 904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904326439 Original CRISPR CTGCCTGGAAGGTGACCTGG GGG Intergenic
No off target data available for this crispr