ID: 904328423

View in Genome Browser
Species Human (GRCh38)
Location 1:29742572-29742594
Sequence CCATGGGGTGGGGGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904328423_904328446 30 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328446 1:29742625-29742647 GGGATTGGGAACATGGGCTGTGG No data
904328423_904328442 16 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328442 1:29742611-29742633 GTCAGTCCTGTGTGGGGATTGGG No data
904328423_904328444 23 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328444 1:29742618-29742640 CTGTGTGGGGATTGGGAACATGG No data
904328423_904328445 24 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328423_904328438 8 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328423_904328440 10 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328440 1:29742605-29742627 AGGCATGTCAGTCCTGTGTGGGG No data
904328423_904328432 -10 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328432 1:29742585-29742607 CACCCCATGGCCATGGTTCCAGG No data
904328423_904328441 15 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328441 1:29742610-29742632 TGTCAGTCCTGTGTGGGGATTGG No data
904328423_904328439 9 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328439 1:29742604-29742626 CAGGCATGTCAGTCCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904328423 Original CRISPR CCATGGGGTGGGGGAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr