ID: 904328428

View in Genome Browser
Species Human (GRCh38)
Location 1:29742581-29742603
Sequence GAACCATGGCCATGGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904328428_904328444 14 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328444 1:29742618-29742640 CTGTGTGGGGATTGGGAACATGG No data
904328428_904328439 0 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328439 1:29742604-29742626 CAGGCATGTCAGTCCTGTGTGGG No data
904328428_904328447 22 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328447 1:29742626-29742648 GGATTGGGAACATGGGCTGTGGG No data
904328428_904328438 -1 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328428_904328440 1 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328440 1:29742605-29742627 AGGCATGTCAGTCCTGTGTGGGG No data
904328428_904328441 6 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328441 1:29742610-29742632 TGTCAGTCCTGTGTGGGGATTGG No data
904328428_904328446 21 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328446 1:29742625-29742647 GGGATTGGGAACATGGGCTGTGG No data
904328428_904328445 15 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328428_904328449 27 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328449 1:29742631-29742653 GGGAACATGGGCTGTGGGACGGG No data
904328428_904328448 26 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328428_904328442 7 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328442 1:29742611-29742633 GTCAGTCCTGTGTGGGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904328428 Original CRISPR GAACCATGGCCATGGGGTGG GGG (reversed) Intergenic
No off target data available for this crispr