ID: 904328432

View in Genome Browser
Species Human (GRCh38)
Location 1:29742585-29742607
Sequence CACCCCATGGCCATGGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904328419_904328432 27 Left 904328419 1:29742535-29742557 CCCTGGCAGCTTGGACTCTCAGA No data
Right 904328432 1:29742585-29742607 CACCCCATGGCCATGGTTCCAGG No data
904328422_904328432 -9 Left 904328422 1:29742571-29742593 CCCTCCTCCTCCCCCACCCCATG No data
Right 904328432 1:29742585-29742607 CACCCCATGGCCATGGTTCCAGG No data
904328420_904328432 26 Left 904328420 1:29742536-29742558 CCTGGCAGCTTGGACTCTCAGAT No data
Right 904328432 1:29742585-29742607 CACCCCATGGCCATGGTTCCAGG No data
904328418_904328432 28 Left 904328418 1:29742534-29742556 CCCCTGGCAGCTTGGACTCTCAG No data
Right 904328432 1:29742585-29742607 CACCCCATGGCCATGGTTCCAGG No data
904328421_904328432 -8 Left 904328421 1:29742570-29742592 CCCCTCCTCCTCCCCCACCCCAT No data
Right 904328432 1:29742585-29742607 CACCCCATGGCCATGGTTCCAGG No data
904328423_904328432 -10 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328432 1:29742585-29742607 CACCCCATGGCCATGGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904328432 Original CRISPR CACCCCATGGCCATGGTTCC AGG Intergenic
No off target data available for this crispr