ID: 904328437

View in Genome Browser
Species Human (GRCh38)
Location 1:29742603-29742625
Sequence CCACACAGGACTGACATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904328437_904328446 -1 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328446 1:29742625-29742647 GGGATTGGGAACATGGGCTGTGG No data
904328437_904328447 0 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328447 1:29742626-29742648 GGATTGGGAACATGGGCTGTGGG No data
904328437_904328449 5 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328449 1:29742631-29742653 GGGAACATGGGCTGTGGGACGGG No data
904328437_904328451 27 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328451 1:29742653-29742675 GAAGTGCCAAGTTCAAGTCTGGG No data
904328437_904328450 26 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328450 1:29742652-29742674 GGAAGTGCCAAGTTCAAGTCTGG No data
904328437_904328448 4 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328437_904328452 28 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328452 1:29742654-29742676 AAGTGCCAAGTTCAAGTCTGGGG No data
904328437_904328445 -7 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328437_904328444 -8 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328444 1:29742618-29742640 CTGTGTGGGGATTGGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904328437 Original CRISPR CCACACAGGACTGACATGCC TGG (reversed) Intergenic
No off target data available for this crispr