ID: 904328438

View in Genome Browser
Species Human (GRCh38)
Location 1:29742603-29742625
Sequence CCAGGCATGTCAGTCCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904328429_904328438 -2 Left 904328429 1:29742582-29742604 CCCCACCCCATGGCCATGGTTCC No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328430_904328438 -3 Left 904328430 1:29742583-29742605 CCCACCCCATGGCCATGGTTCCA No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328421_904328438 10 Left 904328421 1:29742570-29742592 CCCCTCCTCCTCCCCCACCCCAT No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328435_904328438 -9 Left 904328435 1:29742589-29742611 CCATGGCCATGGTTCCAGGCATG No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328423_904328438 8 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328426_904328438 2 Left 904328426 1:29742578-29742600 CCTCCCCCACCCCATGGCCATGG No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328434_904328438 -8 Left 904328434 1:29742588-29742610 CCCATGGCCATGGTTCCAGGCAT No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328433_904328438 -7 Left 904328433 1:29742587-29742609 CCCCATGGCCATGGTTCCAGGCA No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328425_904328438 5 Left 904328425 1:29742575-29742597 CCTCCTCCCCCACCCCATGGCCA No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328431_904328438 -4 Left 904328431 1:29742584-29742606 CCACCCCATGGCCATGGTTCCAG No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328422_904328438 9 Left 904328422 1:29742571-29742593 CCCTCCTCCTCCCCCACCCCATG No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
904328428_904328438 -1 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328438 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904328438 Original CRISPR CCAGGCATGTCAGTCCTGTG TGG Intergenic
No off target data available for this crispr