ID: 904328445

View in Genome Browser
Species Human (GRCh38)
Location 1:29742619-29742641
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904328423_904328445 24 Left 904328423 1:29742572-29742594 CCTCCTCCTCCCCCACCCCATGG No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328431_904328445 12 Left 904328431 1:29742584-29742606 CCACCCCATGGCCATGGTTCCAG No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328435_904328445 7 Left 904328435 1:29742589-29742611 CCATGGCCATGGTTCCAGGCATG No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328428_904328445 15 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328430_904328445 13 Left 904328430 1:29742583-29742605 CCCACCCCATGGCCATGGTTCCA No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328437_904328445 -7 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328426_904328445 18 Left 904328426 1:29742578-29742600 CCTCCCCCACCCCATGGCCATGG No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328422_904328445 25 Left 904328422 1:29742571-29742593 CCCTCCTCCTCCCCCACCCCATG No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328433_904328445 9 Left 904328433 1:29742587-29742609 CCCCATGGCCATGGTTCCAGGCA No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328434_904328445 8 Left 904328434 1:29742588-29742610 CCCATGGCCATGGTTCCAGGCAT No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328429_904328445 14 Left 904328429 1:29742582-29742604 CCCCACCCCATGGCCATGGTTCC No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328425_904328445 21 Left 904328425 1:29742575-29742597 CCTCCTCCCCCACCCCATGGCCA No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328436_904328445 1 Left 904328436 1:29742595-29742617 CCATGGTTCCAGGCATGTCAGTC No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data
904328421_904328445 26 Left 904328421 1:29742570-29742592 CCCCTCCTCCTCCCCCACCCCAT No data
Right 904328445 1:29742619-29742641 TGTGTGGGGATTGGGAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr