ID: 904328448

View in Genome Browser
Species Human (GRCh38)
Location 1:29742630-29742652
Sequence TGGGAACATGGGCTGTGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904328443_904328448 -10 Left 904328443 1:29742617-29742639 CCTGTGTGGGGATTGGGAACATG No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328434_904328448 19 Left 904328434 1:29742588-29742610 CCCATGGCCATGGTTCCAGGCAT No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328437_904328448 4 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328435_904328448 18 Left 904328435 1:29742589-29742611 CCATGGCCATGGTTCCAGGCATG No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328429_904328448 25 Left 904328429 1:29742582-29742604 CCCCACCCCATGGCCATGGTTCC No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328436_904328448 12 Left 904328436 1:29742595-29742617 CCATGGTTCCAGGCATGTCAGTC No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328433_904328448 20 Left 904328433 1:29742587-29742609 CCCCATGGCCATGGTTCCAGGCA No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328428_904328448 26 Left 904328428 1:29742581-29742603 CCCCCACCCCATGGCCATGGTTC No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328426_904328448 29 Left 904328426 1:29742578-29742600 CCTCCCCCACCCCATGGCCATGG No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328431_904328448 23 Left 904328431 1:29742584-29742606 CCACCCCATGGCCATGGTTCCAG No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data
904328430_904328448 24 Left 904328430 1:29742583-29742605 CCCACCCCATGGCCATGGTTCCA No data
Right 904328448 1:29742630-29742652 TGGGAACATGGGCTGTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904328448 Original CRISPR TGGGAACATGGGCTGTGGGA CGG Intergenic
No off target data available for this crispr