ID: 904328452

View in Genome Browser
Species Human (GRCh38)
Location 1:29742654-29742676
Sequence AAGTGCCAAGTTCAAGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904328443_904328452 14 Left 904328443 1:29742617-29742639 CCTGTGTGGGGATTGGGAACATG No data
Right 904328452 1:29742654-29742676 AAGTGCCAAGTTCAAGTCTGGGG No data
904328437_904328452 28 Left 904328437 1:29742603-29742625 CCAGGCATGTCAGTCCTGTGTGG No data
Right 904328452 1:29742654-29742676 AAGTGCCAAGTTCAAGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904328452 Original CRISPR AAGTGCCAAGTTCAAGTCTG GGG Intergenic
No off target data available for this crispr