ID: 904329284

View in Genome Browser
Species Human (GRCh38)
Location 1:29747422-29747444
Sequence CAAGGATCCAAAGATGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329284_904329298 25 Left 904329284 1:29747422-29747444 CCAGGGCCATCTTTGGATCCTTG No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329284_904329286 -7 Left 904329284 1:29747422-29747444 CCAGGGCCATCTTTGGATCCTTG No data
Right 904329286 1:29747438-29747460 ATCCTTGCCTCTCCCTGCCCAGG No data
904329284_904329287 -6 Left 904329284 1:29747422-29747444 CCAGGGCCATCTTTGGATCCTTG No data
Right 904329287 1:29747439-29747461 TCCTTGCCTCTCCCTGCCCAGGG No data
904329284_904329294 18 Left 904329284 1:29747422-29747444 CCAGGGCCATCTTTGGATCCTTG No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data
904329284_904329299 26 Left 904329284 1:29747422-29747444 CCAGGGCCATCTTTGGATCCTTG No data
Right 904329299 1:29747471-29747493 TCCACAGCAGTGTGGGCATCGGG No data
904329284_904329295 19 Left 904329284 1:29747422-29747444 CCAGGGCCATCTTTGGATCCTTG No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329284 Original CRISPR CAAGGATCCAAAGATGGCCC TGG (reversed) Intergenic