ID: 904329285

View in Genome Browser
Species Human (GRCh38)
Location 1:29747428-29747450
Sequence GAGAGGCAAGGATCCAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329285_904329298 19 Left 904329285 1:29747428-29747450 CCATCTTTGGATCCTTGCCTCTC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329285_904329294 12 Left 904329285 1:29747428-29747450 CCATCTTTGGATCCTTGCCTCTC No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data
904329285_904329299 20 Left 904329285 1:29747428-29747450 CCATCTTTGGATCCTTGCCTCTC No data
Right 904329299 1:29747471-29747493 TCCACAGCAGTGTGGGCATCGGG No data
904329285_904329295 13 Left 904329285 1:29747428-29747450 CCATCTTTGGATCCTTGCCTCTC No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329285_904329301 26 Left 904329285 1:29747428-29747450 CCATCTTTGGATCCTTGCCTCTC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329285 Original CRISPR GAGAGGCAAGGATCCAAAGA TGG (reversed) Intergenic