ID: 904329288

View in Genome Browser
Species Human (GRCh38)
Location 1:29747440-29747462
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329288_904329298 7 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329288_904329303 23 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG No data
904329288_904329294 0 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data
904329288_904329295 1 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329288_904329299 8 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329299 1:29747471-29747493 TCCACAGCAGTGTGGGCATCGGG No data
904329288_904329301 14 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329288_904329304 28 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329304 1:29747491-29747513 GGGCAGAGGCTTGGCAGGACTGG No data
904329288_904329302 19 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329288 Original CRISPR GCCCTGGGCAGGGAGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr