ID: 904329289

View in Genome Browser
Species Human (GRCh38)
Location 1:29747445-29747467
Sequence GGGCAGCCCTGGGCAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329289_904329298 2 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329289_904329301 9 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329289_904329294 -5 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data
904329289_904329304 23 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329304 1:29747491-29747513 GGGCAGAGGCTTGGCAGGACTGG No data
904329289_904329295 -4 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329289_904329299 3 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329299 1:29747471-29747493 TCCACAGCAGTGTGGGCATCGGG No data
904329289_904329302 14 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329289_904329303 18 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329289 Original CRISPR GGGCAGCCCTGGGCAGGGAG AGG (reversed) Intergenic