ID: 904329291

View in Genome Browser
Species Human (GRCh38)
Location 1:29747451-29747473
Sequence GGAGATGGGCAGCCCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329291_904329295 -10 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329291_904329302 8 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329291_904329303 12 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG No data
904329291_904329301 3 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329291_904329298 -4 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329291_904329304 17 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329304 1:29747491-29747513 GGGCAGAGGCTTGGCAGGACTGG No data
904329291_904329299 -3 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329299 1:29747471-29747493 TCCACAGCAGTGTGGGCATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329291 Original CRISPR GGAGATGGGCAGCCCTGGGC AGG (reversed) Intergenic