ID: 904329292

View in Genome Browser
Species Human (GRCh38)
Location 1:29747455-29747477
Sequence CTGTGGAGATGGGCAGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329292_904329301 -1 Left 904329292 1:29747455-29747477 CCCAGGGCTGCCCATCTCCACAG No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329292_904329304 13 Left 904329292 1:29747455-29747477 CCCAGGGCTGCCCATCTCCACAG No data
Right 904329304 1:29747491-29747513 GGGCAGAGGCTTGGCAGGACTGG No data
904329292_904329299 -7 Left 904329292 1:29747455-29747477 CCCAGGGCTGCCCATCTCCACAG No data
Right 904329299 1:29747471-29747493 TCCACAGCAGTGTGGGCATCGGG No data
904329292_904329298 -8 Left 904329292 1:29747455-29747477 CCCAGGGCTGCCCATCTCCACAG No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329292_904329303 8 Left 904329292 1:29747455-29747477 CCCAGGGCTGCCCATCTCCACAG No data
Right 904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG No data
904329292_904329302 4 Left 904329292 1:29747455-29747477 CCCAGGGCTGCCCATCTCCACAG No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329292 Original CRISPR CTGTGGAGATGGGCAGCCCT GGG (reversed) Intergenic
No off target data available for this crispr