ID: 904329293

View in Genome Browser
Species Human (GRCh38)
Location 1:29747456-29747478
Sequence GCTGTGGAGATGGGCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329293_904329301 -2 Left 904329293 1:29747456-29747478 CCAGGGCTGCCCATCTCCACAGC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329293_904329298 -9 Left 904329293 1:29747456-29747478 CCAGGGCTGCCCATCTCCACAGC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329293_904329304 12 Left 904329293 1:29747456-29747478 CCAGGGCTGCCCATCTCCACAGC No data
Right 904329304 1:29747491-29747513 GGGCAGAGGCTTGGCAGGACTGG No data
904329293_904329302 3 Left 904329293 1:29747456-29747478 CCAGGGCTGCCCATCTCCACAGC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329293_904329303 7 Left 904329293 1:29747456-29747478 CCAGGGCTGCCCATCTCCACAGC No data
Right 904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG No data
904329293_904329299 -8 Left 904329293 1:29747456-29747478 CCAGGGCTGCCCATCTCCACAGC No data
Right 904329299 1:29747471-29747493 TCCACAGCAGTGTGGGCATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329293 Original CRISPR GCTGTGGAGATGGGCAGCCC TGG (reversed) Intergenic