ID: 904329294

View in Genome Browser
Species Human (GRCh38)
Location 1:29747463-29747485
Sequence TGCCCATCTCCACAGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329289_904329294 -5 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data
904329290_904329294 -10 Left 904329290 1:29747450-29747472 CCCTGCCCAGGGCTGCCCATCTC No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data
904329288_904329294 0 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data
904329284_904329294 18 Left 904329284 1:29747422-29747444 CCAGGGCCATCTTTGGATCCTTG No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data
904329283_904329294 19 Left 904329283 1:29747421-29747443 CCCAGGGCCATCTTTGGATCCTT No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data
904329285_904329294 12 Left 904329285 1:29747428-29747450 CCATCTTTGGATCCTTGCCTCTC No data
Right 904329294 1:29747463-29747485 TGCCCATCTCCACAGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329294 Original CRISPR TGCCCATCTCCACAGCAGTG TGG Intergenic