ID: 904329295

View in Genome Browser
Species Human (GRCh38)
Location 1:29747464-29747486
Sequence GCCCATCTCCACAGCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329289_904329295 -4 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329285_904329295 13 Left 904329285 1:29747428-29747450 CCATCTTTGGATCCTTGCCTCTC No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329283_904329295 20 Left 904329283 1:29747421-29747443 CCCAGGGCCATCTTTGGATCCTT No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329284_904329295 19 Left 904329284 1:29747422-29747444 CCAGGGCCATCTTTGGATCCTTG No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329290_904329295 -9 Left 904329290 1:29747450-29747472 CCCTGCCCAGGGCTGCCCATCTC No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329288_904329295 1 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data
904329291_904329295 -10 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329295 1:29747464-29747486 GCCCATCTCCACAGCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329295 Original CRISPR GCCCATCTCCACAGCAGTGT GGG Intergenic