ID: 904329296 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:29747465-29747487 |
Sequence | GCCCACACTGCTGTGGAGAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904329296_904329302 | -6 | Left | 904329296 | 1:29747465-29747487 | CCCATCTCCACAGCAGTGTGGGC | No data | ||
Right | 904329302 | 1:29747482-29747504 | GTGGGCATCGGGCAGAGGCTTGG | No data | ||||
904329296_904329303 | -2 | Left | 904329296 | 1:29747465-29747487 | CCCATCTCCACAGCAGTGTGGGC | No data | ||
Right | 904329303 | 1:29747486-29747508 | GCATCGGGCAGAGGCTTGGCAGG | No data | ||||
904329296_904329304 | 3 | Left | 904329296 | 1:29747465-29747487 | CCCATCTCCACAGCAGTGTGGGC | No data | ||
Right | 904329304 | 1:29747491-29747513 | GGGCAGAGGCTTGGCAGGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904329296 | Original CRISPR | GCCCACACTGCTGTGGAGAT GGG (reversed) | Intergenic | ||