ID: 904329296

View in Genome Browser
Species Human (GRCh38)
Location 1:29747465-29747487
Sequence GCCCACACTGCTGTGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329296_904329303 -2 Left 904329296 1:29747465-29747487 CCCATCTCCACAGCAGTGTGGGC No data
Right 904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG No data
904329296_904329304 3 Left 904329296 1:29747465-29747487 CCCATCTCCACAGCAGTGTGGGC No data
Right 904329304 1:29747491-29747513 GGGCAGAGGCTTGGCAGGACTGG No data
904329296_904329302 -6 Left 904329296 1:29747465-29747487 CCCATCTCCACAGCAGTGTGGGC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329296 Original CRISPR GCCCACACTGCTGTGGAGAT GGG (reversed) Intergenic