ID: 904329297

View in Genome Browser
Species Human (GRCh38)
Location 1:29747466-29747488
Sequence TGCCCACACTGCTGTGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329297_904329303 -3 Left 904329297 1:29747466-29747488 CCATCTCCACAGCAGTGTGGGCA No data
Right 904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG No data
904329297_904329302 -7 Left 904329297 1:29747466-29747488 CCATCTCCACAGCAGTGTGGGCA No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329297_904329304 2 Left 904329297 1:29747466-29747488 CCATCTCCACAGCAGTGTGGGCA No data
Right 904329304 1:29747491-29747513 GGGCAGAGGCTTGGCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329297 Original CRISPR TGCCCACACTGCTGTGGAGA TGG (reversed) Intergenic
No off target data available for this crispr