ID: 904329297 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:29747466-29747488 |
| Sequence | TGCCCACACTGCTGTGGAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904329297_904329303 | -3 | Left | 904329297 | 1:29747466-29747488 | CCATCTCCACAGCAGTGTGGGCA | No data | ||
| Right | 904329303 | 1:29747486-29747508 | GCATCGGGCAGAGGCTTGGCAGG | No data | ||||
| 904329297_904329302 | -7 | Left | 904329297 | 1:29747466-29747488 | CCATCTCCACAGCAGTGTGGGCA | No data | ||
| Right | 904329302 | 1:29747482-29747504 | GTGGGCATCGGGCAGAGGCTTGG | No data | ||||
| 904329297_904329304 | 2 | Left | 904329297 | 1:29747466-29747488 | CCATCTCCACAGCAGTGTGGGCA | No data | ||
| Right | 904329304 | 1:29747491-29747513 | GGGCAGAGGCTTGGCAGGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904329297 | Original CRISPR | TGCCCACACTGCTGTGGAGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||