ID: 904329298

View in Genome Browser
Species Human (GRCh38)
Location 1:29747470-29747492
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329284_904329298 25 Left 904329284 1:29747422-29747444 CCAGGGCCATCTTTGGATCCTTG No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329291_904329298 -4 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329289_904329298 2 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329293_904329298 -9 Left 904329293 1:29747456-29747478 CCAGGGCTGCCCATCTCCACAGC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329283_904329298 26 Left 904329283 1:29747421-29747443 CCCAGGGCCATCTTTGGATCCTT No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329285_904329298 19 Left 904329285 1:29747428-29747450 CCATCTTTGGATCCTTGCCTCTC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329290_904329298 -3 Left 904329290 1:29747450-29747472 CCCTGCCCAGGGCTGCCCATCTC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329288_904329298 7 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data
904329292_904329298 -8 Left 904329292 1:29747455-29747477 CCCAGGGCTGCCCATCTCCACAG No data
Right 904329298 1:29747470-29747492 CTCCACAGCAGTGTGGGCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type