ID: 904329300

View in Genome Browser
Species Human (GRCh38)
Location 1:29747472-29747494
Sequence GCCCGATGCCCACACTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329300_904329304 -4 Left 904329300 1:29747472-29747494 CCACAGCAGTGTGGGCATCGGGC No data
Right 904329304 1:29747491-29747513 GGGCAGAGGCTTGGCAGGACTGG No data
904329300_904329303 -9 Left 904329300 1:29747472-29747494 CCACAGCAGTGTGGGCATCGGGC No data
Right 904329303 1:29747486-29747508 GCATCGGGCAGAGGCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329300 Original CRISPR GCCCGATGCCCACACTGCTG TGG (reversed) Intergenic