ID: 904329301

View in Genome Browser
Species Human (GRCh38)
Location 1:29747477-29747499
Sequence GCAGTGTGGGCATCGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329288_904329301 14 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329292_904329301 -1 Left 904329292 1:29747455-29747477 CCCAGGGCTGCCCATCTCCACAG No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329291_904329301 3 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329290_904329301 4 Left 904329290 1:29747450-29747472 CCCTGCCCAGGGCTGCCCATCTC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329293_904329301 -2 Left 904329293 1:29747456-29747478 CCAGGGCTGCCCATCTCCACAGC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329289_904329301 9 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data
904329285_904329301 26 Left 904329285 1:29747428-29747450 CCATCTTTGGATCCTTGCCTCTC No data
Right 904329301 1:29747477-29747499 GCAGTGTGGGCATCGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329301 Original CRISPR GCAGTGTGGGCATCGGGCAG AGG Intergenic