ID: 904329302

View in Genome Browser
Species Human (GRCh38)
Location 1:29747482-29747504
Sequence GTGGGCATCGGGCAGAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904329289_904329302 14 Left 904329289 1:29747445-29747467 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329296_904329302 -6 Left 904329296 1:29747465-29747487 CCCATCTCCACAGCAGTGTGGGC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329297_904329302 -7 Left 904329297 1:29747466-29747488 CCATCTCCACAGCAGTGTGGGCA No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329292_904329302 4 Left 904329292 1:29747455-29747477 CCCAGGGCTGCCCATCTCCACAG No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329288_904329302 19 Left 904329288 1:29747440-29747462 CCTTGCCTCTCCCTGCCCAGGGC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329291_904329302 8 Left 904329291 1:29747451-29747473 CCTGCCCAGGGCTGCCCATCTCC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329290_904329302 9 Left 904329290 1:29747450-29747472 CCCTGCCCAGGGCTGCCCATCTC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data
904329293_904329302 3 Left 904329293 1:29747456-29747478 CCAGGGCTGCCCATCTCCACAGC No data
Right 904329302 1:29747482-29747504 GTGGGCATCGGGCAGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904329302 Original CRISPR GTGGGCATCGGGCAGAGGCT TGG Intergenic