ID: 904330309

View in Genome Browser
Species Human (GRCh38)
Location 1:29754256-29754278
Sequence CGGTGGGCCTGGCACTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904330309_904330314 -10 Left 904330309 1:29754256-29754278 CCCACTGAGTGCCAGGCCCACCG No data
Right 904330314 1:29754269-29754291 AGGCCCACCGCTGAGGGCTCAGG No data
904330309_904330315 -9 Left 904330309 1:29754256-29754278 CCCACTGAGTGCCAGGCCCACCG No data
Right 904330315 1:29754270-29754292 GGCCCACCGCTGAGGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904330309 Original CRISPR CGGTGGGCCTGGCACTCAGT GGG (reversed) Intergenic
No off target data available for this crispr