ID: 904330472

View in Genome Browser
Species Human (GRCh38)
Location 1:29755121-29755143
Sequence GCTGCTGTTGGCCCTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904330467_904330472 21 Left 904330467 1:29755077-29755099 CCACAGCACAGTGCCTGGTACAC No data
Right 904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG No data
904330466_904330472 22 Left 904330466 1:29755076-29755098 CCCACAGCACAGTGCCTGGTACA No data
Right 904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG No data
904330469_904330472 8 Left 904330469 1:29755090-29755112 CCTGGTACACAGTGGCTCTCAGT No data
Right 904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904330472 Original CRISPR GCTGCTGTTGGCCCTCAAGC AGG Intergenic
No off target data available for this crispr