ID: 904334102

View in Genome Browser
Species Human (GRCh38)
Location 1:29785819-29785841
Sequence CTCCCCAGCAGGGGCCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904334102_904334109 0 Left 904334102 1:29785819-29785841 CCTCTCAGGCCCCTGCTGGGGAG No data
Right 904334109 1:29785842-29785864 GAGTCAGGGACTTGCTATTTTGG No data
904334102_904334113 30 Left 904334102 1:29785819-29785841 CCTCTCAGGCCCCTGCTGGGGAG No data
Right 904334113 1:29785872-29785894 CCTGTGCTTCAGACTTGATGAGG No data
904334102_904334110 1 Left 904334102 1:29785819-29785841 CCTCTCAGGCCCCTGCTGGGGAG No data
Right 904334110 1:29785843-29785865 AGTCAGGGACTTGCTATTTTGGG No data
904334102_904334111 2 Left 904334102 1:29785819-29785841 CCTCTCAGGCCCCTGCTGGGGAG No data
Right 904334111 1:29785844-29785866 GTCAGGGACTTGCTATTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904334102 Original CRISPR CTCCCCAGCAGGGGCCTGAG AGG (reversed) Intergenic
No off target data available for this crispr