ID: 904336297

View in Genome Browser
Species Human (GRCh38)
Location 1:29800468-29800490
Sequence GGTGAACTCCTCCACAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904336297_904336310 27 Left 904336297 1:29800468-29800490 CCGGGGCTGTGGAGGAGTTCACC No data
Right 904336310 1:29800518-29800540 AGGCTGGGAAGCAACAGCCCAGG No data
904336297_904336300 7 Left 904336297 1:29800468-29800490 CCGGGGCTGTGGAGGAGTTCACC No data
Right 904336300 1:29800498-29800520 CACCCCCGTTCCTCTCCTCCAGG No data
904336297_904336306 12 Left 904336297 1:29800468-29800490 CCGGGGCTGTGGAGGAGTTCACC No data
Right 904336306 1:29800503-29800525 CCGTTCCTCTCCTCCAGGCTGGG No data
904336297_904336304 11 Left 904336297 1:29800468-29800490 CCGGGGCTGTGGAGGAGTTCACC No data
Right 904336304 1:29800502-29800524 CCCGTTCCTCTCCTCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904336297 Original CRISPR GGTGAACTCCTCCACAGCCC CGG (reversed) Intergenic
No off target data available for this crispr