ID: 904338114

View in Genome Browser
Species Human (GRCh38)
Location 1:29810949-29810971
Sequence ACATTCCTCCTTGAAGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904338114_904338119 -7 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338119 1:29810965-29810987 GGAATGTGTGAGGCGAAGGAGGG No data
904338114_904338125 15 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338125 1:29810987-29811009 GTGGTCAGAAGCTGTGGGTGGGG No data
904338114_904338123 13 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338123 1:29810985-29811007 GGGTGGTCAGAAGCTGTGGGTGG No data
904338114_904338128 26 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338128 1:29810998-29811020 CTGTGGGTGGGGCTGGCTTTGGG No data
904338114_904338127 25 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG No data
904338114_904338118 -8 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338118 1:29810964-29810986 AGGAATGTGTGAGGCGAAGGAGG No data
904338114_904338122 10 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338122 1:29810982-29811004 GGAGGGTGGTCAGAAGCTGTGGG No data
904338114_904338120 -4 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338120 1:29810968-29810990 ATGTGTGAGGCGAAGGAGGGTGG No data
904338114_904338121 9 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338121 1:29810981-29811003 AGGAGGGTGGTCAGAAGCTGTGG No data
904338114_904338124 14 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338124 1:29810986-29811008 GGTGGTCAGAAGCTGTGGGTGGG No data
904338114_904338126 19 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338126 1:29810991-29811013 TCAGAAGCTGTGGGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904338114 Original CRISPR ACATTCCTCCTTGAAGACCT GGG (reversed) Intergenic