ID: 904338127

View in Genome Browser
Species Human (GRCh38)
Location 1:29810997-29811019
Sequence GCTGTGGGTGGGGCTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904338114_904338127 25 Left 904338114 1:29810949-29810971 CCCAGGTCTTCAAGGAGGAATGT No data
Right 904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG No data
904338115_904338127 24 Left 904338115 1:29810950-29810972 CCAGGTCTTCAAGGAGGAATGTG No data
Right 904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904338127 Original CRISPR GCTGTGGGTGGGGCTGGCTT TGG Intergenic