ID: 904341941

View in Genome Browser
Species Human (GRCh38)
Location 1:29841177-29841199
Sequence GAGGAGAAGCATAAGGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904341941_904341945 10 Left 904341941 1:29841177-29841199 CCAATCACCTTATGCTTCTCCTC No data
Right 904341945 1:29841210-29841232 TTTTGACACAGCAACTGACCAGG No data
904341941_904341947 29 Left 904341941 1:29841177-29841199 CCAATCACCTTATGCTTCTCCTC No data
Right 904341947 1:29841229-29841251 CAGGATTCCTTCCTGATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904341941 Original CRISPR GAGGAGAAGCATAAGGTGAT TGG (reversed) Intergenic
No off target data available for this crispr