ID: 904342090

View in Genome Browser
Species Human (GRCh38)
Location 1:29842873-29842895
Sequence ACATACAAACAAAATTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904342086_904342090 18 Left 904342086 1:29842832-29842854 CCTGAACAACATAGAGAGACCCT No data
Right 904342090 1:29842873-29842895 ACATACAAACAAAATTTGGAAGG No data
904342088_904342090 -2 Left 904342088 1:29842852-29842874 CCTGTTTCTAAAAATAAACAAAC No data
Right 904342090 1:29842873-29842895 ACATACAAACAAAATTTGGAAGG No data
904342085_904342090 22 Left 904342085 1:29842828-29842850 CCAGCCTGAACAACATAGAGAGA No data
Right 904342090 1:29842873-29842895 ACATACAAACAAAATTTGGAAGG No data
904342087_904342090 -1 Left 904342087 1:29842851-29842873 CCCTGTTTCTAAAAATAAACAAA No data
Right 904342090 1:29842873-29842895 ACATACAAACAAAATTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904342090 Original CRISPR ACATACAAACAAAATTTGGA AGG Intergenic
No off target data available for this crispr