ID: 904344308

View in Genome Browser
Species Human (GRCh38)
Location 1:29857888-29857910
Sequence GAGGCAGCTGGTGCTCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904344301_904344308 21 Left 904344301 1:29857844-29857866 CCTCTGCTCCCTGCAACTGCTGC No data
Right 904344308 1:29857888-29857910 GAGGCAGCTGGTGCTCTGTGAGG No data
904344303_904344308 12 Left 904344303 1:29857853-29857875 CCTGCAACTGCTGCGACTCATCC No data
Right 904344308 1:29857888-29857910 GAGGCAGCTGGTGCTCTGTGAGG No data
904344300_904344308 22 Left 904344300 1:29857843-29857865 CCCTCTGCTCCCTGCAACTGCTG No data
Right 904344308 1:29857888-29857910 GAGGCAGCTGGTGCTCTGTGAGG No data
904344302_904344308 13 Left 904344302 1:29857852-29857874 CCCTGCAACTGCTGCGACTCATC No data
Right 904344308 1:29857888-29857910 GAGGCAGCTGGTGCTCTGTGAGG No data
904344305_904344308 -9 Left 904344305 1:29857874-29857896 CCTCTTCGCCTGCAGAGGCAGCT No data
Right 904344308 1:29857888-29857910 GAGGCAGCTGGTGCTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904344308 Original CRISPR GAGGCAGCTGGTGCTCTGTG AGG Intergenic
No off target data available for this crispr