ID: 904344393

View in Genome Browser
Species Human (GRCh38)
Location 1:29858433-29858455
Sequence TGCCAAGGTTGAGGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904344389_904344393 21 Left 904344389 1:29858389-29858411 CCAAAAAAAGCAACTGAGGCGCA No data
Right 904344393 1:29858433-29858455 TGCCAAGGTTGAGGGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904344393 Original CRISPR TGCCAAGGTTGAGGGTGTGC TGG Intergenic
No off target data available for this crispr